HashMap and finding index difference

[Imran Bhutta]

i have a program thats has a data file that contains different strings like
ATGTCATGG
ATGCGATGGGGGGTCGCCCC
ATGTTT
the out put would be for this
the closest two are 3 apart in length
their indices are 0,2.

And the code so far that i have writen reads the file and checks how long each of the strngs are and it gives me what order the string is in. i have all this saved into a HashMap becasue an array list can only hold one value and hash map can hold 2. but my problem is that i cant figure out how do get the difference between the strings. the program is sapoose to find the clostest 2 and see how much they are apart by. i dont konw what to do with the hash map, becasue i cant sort the values .....



thankx

import type.lang.*;
import type.lib.*;
import java.util.*;
 
public class Check10A {
    public static void main(String[] args)
    
    {int count = -1;
    HashMap num1 = new HashMap();
    ArrayList num = new ArrayList();
    String dna = new String();
    IO.print("Enter the filename ");
    String file = IO.readLine();
    List filedat = (List) IO.readObject(file);
   Iterator it = filedat.iterator();
   for(; it.hasNext() ;) 
   { 
   String str = (String)it.next();
   count++;
   
   num1.put(""+str.length(),""+count);
   
   //num1add(new Integer(str.length()));
 }
//Collections.sort(num);
IO.println(num1);

  
  }}
    

[ edited to disable smilies -ds ]
[ November 28, 2004: Message edited by: Dirk Schreckmann ]

[Jeanne Boyarsky]

Imran,
You can sort the values by getting the values. For example, map.values() return a list you can sort. It's just the values though, so you would need to loop through again to get the key that goes with the value you are looking for.

[Dirk Schreckmann]

Moving this to the Intermediate forum...